Cyclophosphamide (Cytoxan)

Raw research findings for this medication. Mostly single studies, not curated or confirmed robust.

About Cyclophosphamide

What it is

Cyclophosphamide is an alkylating medicine that the liver activates into a mustard that cross-links DNA. At higher doses it is a chemotherapy for breast cancer, lymphomas, leukaemias and other cancers and is used before stem cell transplants; at lower doses it suppresses the immune system in severe lupus, vasculitis and other autoimmune diseases. It is sold as Cytoxan and Endoxan, among other names.

How genes come into it

Cyclophosphamide is a prodrug activated mainly by CYP2B6, with CYP2C19, CYP2C9 and CYP3A4 contributing. Studies have linked slower CYP2B6 and CYP2C19 versions to less activation, and glutathione transferase genes (GSTP1, GSTA1) and ABCB1 to response and side effects, in lupus and in cancer. The findings come from single or a few studies and often disagree, and there is no CPIC or DPWG guideline.

What research found

Every published finding on gene variants and Cyclophosphamide. Upload your DNA file to see which of these rows apply to you.

Rated evidence (124 rated variants)

PharmGKB weighs all studies of a variant and rates how strong the evidence is, from 1A (strongest) to 4.

GSTP1 rs1695: Level 3. Efficacy: Neoplasms. 5.

CYP2C19 rs4244285: Level 3. Efficacy: Breast Neoplasms. 2.

CYP2C19 rs4244285: Level 3. Toxicity: Systemic lupus erythematosus. 2.

SLC22A16 rs714368: Level 3. Efficacy, Toxicity: Breast Neoplasms. 2.

Metabolism (13 findings)

Studies of how quickly the body processes this medication.

CYP2B6 CYP2B6*1, CYP2B6*29: CYP2B6 *1/*29 is associated with decreased metabolism of cyclophosphamide in people with Lymphoma, Non-Hodgkin as compared to CYP2B6 *1/*1.

CYP2B6 CYP2B6*1, CYP2B6*30: CYP2B6 *1/*30 is associated with decreased metabolism of cyclophosphamide in people with Lymphoma, Non-Hodgkin as compared to CYP2B6 *1/*1.

CYP2B6 CYP2B6*1, CYP2B6*6: CYP2B6 *6 is associated with decreased metabolism of cyclophosphamide in people with Lymphoma, Non-Hodgkin as compared to CYP2B6 *1/*1.

CYP2B6 CYP2B6*1, CYP2B6*6: CYP2B6 *6 is associated with decreased clearance of cyclophosphamide in children with Lymphoma, B-Cell as compared to CYP2B6 *1/*1.

Response (73 findings)

Studies of how well it worked in people carrying a variant.

ABCC2 rs145008610: Genotype AA is associated with decreased clinical benefit to cyclophosphamide, doxorubicin and paclitaxel in people with Breast Neoplasms as compared to genotypes AC + CC.

ALDH1A1 rs13959: Genotypes AG + GG is associated with increased clinical benefit to cyclophosphamide, doxorubicin, FEC100 or fluorouracil in people with Breast Neoplasms.

ALDH1A1 rs6151031: Genotype CTGGTGAGGAGAGAACC/del is associated with decreased response to cyclophosphamide and doxorubicin in women with Breast Neoplasms as compared to genotype CTGGTGAGGAGAGAACC/CTGGTGAGGAGAGAACC.

CTNNB1 rs4135385: Genotype AA is associated with increased response to cyclophosphamide, dexamethasone and thalidomide in people with Multiple Myeloma as compared to genotypes AG + GG.

Side effects (1 finding)

Studies of side effects in people carrying a variant.

C18orf56, TYMS rs45445694: Allele (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is not associated with response to cisplatin, cyclophosphamide, dactinomycin, doxorubicin, methotrexate and vincristine in children with Osteosarcoma as compared to allele (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2.

Study findings and evidence levels: PharmGKB (CC BY-SA 4.0). Guidelines: CPIC and DPWG, as bundled in PharmCAT. Most studies were done mainly in people of European ancestry.

Related Drugs

More drugs from the same category

Alkeran (Alkylating Agents)

Alkylating Agents (class) (Alkylating Agents)

DTIC-Dome (Alkylating Agents)

Not a prescribing recommendation. This page is educational information about pharmacogenomic research and clinical guidelines - it is not medical or dosing advice, and not a prediction of how any medication will work for you. Never start, stop, or change a medication or dose based on it; talk to your doctor or pharmacist, who can order clinical-grade testing if appropriate.

Back to Medications

Content updated September 2026.

ReadYourDNA provides educational interpretation of DNA data you already have. It is not diagnostic, not a substitute for professional medical advice, diagnosis, or treatment, and is not intended to diagnose, treat, cure, or prevent any disease. Talk to a clinician before acting on any result.

Raw DNA Data Reports for 23andMe & AncestryDNA · About ReadYourDNA · FAQ · Methodology & Science · Pricing · Support and complaints · Legal & Contact · Health Traits · Pharmacogenomics · Carrier Status · Variant Explorer · The Human Karyotype · Privacy Policy · Terms of Service · Accessibility · Consumer Health Data Privacy · Your Privacy Choices · Editorial Standards · Your Data, Checkable · Sample Report · ReadYourDNA and Promethease compared · What is inside a 23andMe raw data file · What is inside an AncestryDNA raw data file · What a chatbot can and cannot do with your raw DNA file · Where a raw DNA file can still be uploaded in 2026

Written, maintained and operated by Martin Pechhacker, sole proprietor, Vienna, Austria. Trade register GISA 40064420. support@readyourdna.com